The Future of Life

Filename: the-future-of-life.pdf
ISBN: 9780375414565
Release Date: 2002-04-09
Number of pages: 256
Author: Edward O. Wilson
Publisher: Vintage

Download and read online The Future of Life in PDF and EPUB One of the world’s most important scientists, Edward O. Wilson is also an abundantly talented writer who has twice won the Pulitzer Prize. In this, his most personal and timely book to date, he assesses the precarious state of our environment, examining the mass extinctions occurring in our time and the natural treasures we are about to lose forever. Yet, rather than eschewing doomsday prophesies, he spells out a specific plan to save our world while there is still time. His vision is a hopeful one, as economically sound as it is environmentally necessary. Eloquent, practical and wise, this book should be read and studied by anyone concerned with the fate of the natural world.


The Future of Life

Filename: the-future-of-life.pdf
ISBN: 9780679768111
Release Date: 2003
Number of pages: 229
Author: Edward O. Wilson
Publisher: Vintage

Download and read online The Future of Life in PDF and EPUB Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.


The Future of Life

Filename: the-future-of-life.pdf
ISBN: 9780679450788
Release Date: 2002-01-01
Number of pages: 229
Author: Edward O. Wilson
Publisher: Knopf

Download and read online The Future of Life in PDF and EPUB Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.


Creation

Filename: creation.pdf
ISBN: 9780141970226
Release Date: 2013-04-04
Number of pages: 272
Author: Adam Rutherford
Publisher: Penguin UK

Download and read online Creation in PDF and EPUB 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG


The Future of Life on Earth

Filename: the-future-of-life-on-earth.pdf
ISBN: 9781406232622
Release Date: 2013-02-01
Number of pages: 48
Author: Michael Bright
Publisher: Raintree

Download and read online The Future of Life on Earth in PDF and EPUB Explains how many of the living things on Earth are still to be found and described, as well as things that affect biodiversity and what our world might look like in years to come. Looks at ways that human activity is affecting biodiversity and how that may play out in the future of life on Earth based on past instances of mass extinction, and also looks forward to the time when the Sun will no longer support life on the planet.


Dodging Extinction

Filename: dodging-extinction.pdf
ISBN: 9780520274372
Release Date: 2014-10-01
Number of pages: 240
Author: Anthony D. Barnosky
Publisher: Univ of California Press

Download and read online Dodging Extinction in PDF and EPUB Paleobiologist Anthony D. Barnosky weaves together evidence from the deep past and the present to alert us to the looming Sixth Mass Extinction and to offer a practical, hopeful plan for avoiding it. Writing from the front lines of extinction research, Barnosky tells the overarching story of geologic and evolutionary history and how it informs the way humans inhabit, exploit, and impact Earth today. He presents compelling evidence that unless we rethink how we generate the power we use to run our global ecosystem, where we get our food, and how we make our money, we will trigger what would be the sixth great extinction on Earth, with dire consequences. Optimistic that we can change this ominous forecast if we act now, Barnosky provides clear-cut strategies to guide the planet away from global catastrophe. In many instances the necessary technology and know-how already exist and are being applied to crucial issues around human-caused climate change, feeding the world’s growing population, and exploiting natural resources. Deeply informed yet accessibly written, Dodging Extinction is nothing short of a guidebook for saving the planet.


The Diversity of Life

Filename: the-diversity-of-life.pdf
ISBN: 9780141931739
Release Date: 2001-04-26
Number of pages: 432
Author: Edward O Wilson
Publisher: Penguin UK

Download and read online The Diversity of Life in PDF and EPUB "Not since Darwin has an author so lifted the science of ecology with insight and delightful imagery" - Richard Dawkins In this book a master scientist tells the great story of how life on earth evolved. E.O. Wilson eloquently describes how the species of the world became diverse, and why the threat to this diversity today is beyond the scope of anything we have known before. In an extensive new foreword for this edition, Professor Wilson addresses the explosion of the field of conservation biology and takes a clear-eyed look at the work still to be done.


The Future of Life Meta Evolution

Filename: the-future-of-life-meta-evolution.pdf
ISBN: 9781425726843
Release Date: 2006-10-01
Number of pages: 404
Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut

Download and read online The Future of Life Meta Evolution in PDF and EPUB The Future of Life: Meta-Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe, both organic and inorganic. These include all facets of human existence and civilisation- the sciences, technology, arts, humanities and religion. In essence, by applying quantum information, network and decision theory, it is demonstrated that an overarching evolutionary process shapes the spectrum of life and phenomena in the universe, as a generic paradigm beyond Darwin's original biology-based theory. The Theory of Evolution is undoubtedly the most powerful paradigm ever conceived by humans to explain their own existence. Since Darwin´s epoch-making treatise, Origin of Species', published in 1859, evolution has been centre-stage, universally recognised as the driving force in the emergence of modern humans from the genesis of life on this planet almost 4 billion years ago. However, despite its ubiquitous brilliance as the jewel in the crown of human intellectual achievement, the notion of evolution has never been developed to its full potential. It remains instead constrained within its biological cradle, often reduced in everyday connotation to its lowest common denominator of ´survival of the fittest´. The intention of this book to re-evaluate and expand the Darwinian model of evolution; to demonstrate that its current application is only the tip of the intellectual iceberg and that by combining its formidable biological principles with those of decision complexity, network, quantum and information theory, it emerges as an incalculably deeper and richer model than previously contemplated. It will be demonstrated that the evolutionary engine which drives biological development, also drives all other dynamic adaptive processes- the physical, social, cognitive, economic, political and technological and is in fact the major dynamic governing the Universe, past present and future. It is further proposed to demonstrate that recent developments in artificial intelligence and ubiquitous computing through the Internet, mark the next crucial stage in life's evolution, involving the inevitable symbiosis of vast computational intelligence with the human mind. The major hypothesis developed in this book, of a global all-encompassing Theory of Evolution, coupled with its potential for realising the emancipation of human intelligence and potential, provides a vastly more powerful paradigm for exploring the Future of Life than current scientific scenarios. The resulting Omega state of infinite knowledge and wisdom which is proposed, has been actively championed by a number of eminent 19th and 20th century philosophers such as Teillhard de Chardin, Henri Bergson, Schelling, Alfred Whitehead, Samuel Alexander and more recently by the leading physicist and futurist- Professor Frank Tipler. However to date no equivalent scientific framework for supporting such a hypothesis has been provided. In conclusion, The Future of Life: Meta-Evolution has been written not as an academic text but as primarily a non-technical review of the evidence to support such a hypothesis, in much the same vein as other recent publications in the popular science/philosophy genre. It is hoped that this approach will therefore provide a window into the wider evolutionary debate for the general reader interested in one of the most critical emerging paradigm shifts of the 21st century.


Half Earth Our Planet s Fight for Life

Filename: half-earth-our-planet-s-fight-for-life.pdf
ISBN: 9781631490835
Release Date: 2016-03-07
Number of pages: 256
Author: Edward O. Wilson
Publisher: W. W. Norton & Company

Download and read online Half Earth Our Planet s Fight for Life in PDF and EPUB Half-Earth proposes an achievable plan to save our imperiled biosphere: devote half the surface of the Earth to nature. In order to stave off the mass extinction of species, including our own, we must move swiftly to preserve the biodiversity of our planet, says Edward O. Wilson in his most impassioned book to date. Half-Earth argues that the situation facing us is too large to be solved piecemeal and proposes a solution commensurate with the magnitude of the problem: dedicate fully half the surface of the Earth to nature. If we are to undertake such an ambitious endeavor, we first must understand just what the biosphere is, why it's essential to our survival, and the manifold threats now facing it. In doing so, Wilson describes how our species, in only a mere blink of geological time, became the architects and rulers of this epoch and outlines the consequences of this that will affect all of life, both ours and the natural world, far into the future. Half-Earth provides an enormously moving and naturalistic portrait of just what is being lost when we clip "twigs and eventually whole braches of life's family tree." In elegiac prose, Wilson documents the many ongoing extinctions that are imminent, paying tribute to creatures great and small, not the least of them the two Sumatran rhinos whom he encounters in captivity. Uniquely, Half-Earth considers not only the large animals and star species of plants but also the millions of invertebrate animals and microorganisms that, despite being overlooked, form the foundations of Earth's ecosystems. In stinging language, he avers that the biosphere does not belong to us and addresses many fallacious notions such as the idea that ongoing extinctions can be balanced out by the introduction of alien species into new ecosystems or that extinct species might be brought back through cloning. This includes a critique of the "anthropocenists," a fashionable collection of revisionist environmentalists who believe that the human species alone can be saved through engineering and technology. Despite the Earth's parlous condition, Wilson is no doomsayer, resigned to fatalism. Defying prevailing conventional wisdom, he suggests that we still have time to put aside half the Earth and identifies actual spots where Earth's biodiversity can still be reclaimed. Suffused with a profound Darwinian understanding of our planet's fragility, Half-Earth reverberates with an urgency like few other books, but it offers an attainable goal that we can strive for on behalf of all life.



What is Life The Next Fifty Years

Filename: what-is-life-the-next-fifty-years.pdf
ISBN: 0521599393
Release Date: 1997-03-13
Number of pages: 191
Author: Michael P. Murphy
Publisher: Cambridge University Press

Download and read online What is Life The Next Fifty Years in PDF and EPUB Erwin Schrödinger's book What is Life?, which was originally delivered as a set of lectures at Trinity College, Dublin, is perhaps one of the most important scientific books of the twentieth century. It marked the beginning of molecular biology, and stimulated scientists such as Watson and Crick to explore and discover the structure of DNA. The novelty and appeal of What is Life? is that Schrödinger addressed the central problems of biology--heredity and how organisms use energy to maintain order--from a physicist's perspective. Fifty years later, at Trinity College, a number of outstanding scientists from a range of disciplines gathered to celebrate the anniversary of Schrödinger's lectures. In this book, they present their views on the current main problems in biology. The contributors are eminent scientists (including two Nobel Laureates) and well-known writers of popular science, including Jared Diamond, Christien de Duve, Manfred Eigen, Stephen Jay Gould, Stuart Kauffman, John Maynard Smith, Roger Penrose, and Lewis Wolpert. They tackle questions on our current understanding of the origin of life, evolution, the origin of human inventiveness, developmental biology, and the basis for consciousness. The book ends with a touching biography by Schrödinger's daughter, Ruth Braunizer. This book will set the stage for biological research into the next century and is essential reading for anyone interested in biology and its future.


The Connected Home The Future of Domestic Life

Filename: the-connected-home-the-future-of-domestic-life.pdf
ISBN: 9780857294760
Release Date: 2012-01-11
Number of pages: 305
Author: Richard Harper
Publisher: Springer Science & Business Media

Download and read online The Connected Home The Future of Domestic Life in PDF and EPUB The title of this new book: “The Connected Home” reflects the move away from the idea that smart homes would alter the lives of those living in them by providing technologies to take over tasks that were previously the responsibility of the householder, such as managing entertainment, education – and even eating! Up until around 10 years ago this view was commonplace but time has shown that the technologies to support a smart home have not developed in such a way as to support this premise. Instead, what people do in their homes has moved the concept of a smart home into that of the ‘connected home’. The rise of on-line games technologies, video connections via Skype, social networking, internet browsing etc are now an integral part of the home environment and have had a significant effect on the home. The contributors to this exciting new book consider and discuss the effects and ramifications of the connected home from a variety of viewpoints: an examination of the take-up of personal computers and the Internet in domestic situations; an analysis of the changing intersection of technology and human habits in the connected home; the impact of gaming, texting, e-book readers, tablets and other devices and their effect on the social conditions of a household; the relationship between digital messaging applications and real geography; and an overview of how sensing technologies for the smart home might evolve (lightweight medical technologies for example). The book culminates by addressing unfinished ambitions from the smart home agenda, the factors that have prevented their realisation, and addresses the need for extending research into the area.


Elephants in Space

Filename: elephants-in-space.pdf
ISBN: 9783319056722
Release Date: 2014-05-30
Number of pages: 189
Author: Ben Moore
Publisher: Springer

Download and read online Elephants in Space in PDF and EPUB This book is about the history and future of life and the universe, written at a level that any educated lay-person can understand and enjoy. It describes our place in time and space, how we got here and where we are going. It will take you on a journey from the beginning of time to the end of the universe to uncover our origins and reveal our destiny. It will explain how mankind acquired this knowledge starting from the beginning of civilization when the ancient Greeks first began to ask questions about the nature of the world around them. Ben Moore takes us on a path of discovery that connects astrophysics with subjects as varied as biology, neuroscience and evolution; from the origin of atoms to how stars shine and die, from ants and elephants to space travel and extra-terrestrial life. But as our universe grows older and its stars fade away and stop shining, can life continue for eternity or is all life destined for complete extinction? And what is the purpose of all of this anyway?! On the German edition: "With his public talks and his new book "Elefanten im All" the Brit is on his way of becoming a popstar of science. Moore has a story to tell. The story of everything. From the beginning to the end of our existence. And he does so with esprit and catching passion." Rico Bandle, Weltwoche, 1. November 2012 “The kind of book you come across only every few years.” Artur K. Vogel, Der Bund, September 2012.


The Future of Assisted Suicide and Euthanasia

Filename: the-future-of-assisted-suicide-and-euthanasia.pdf
ISBN: 0691140979
Release Date: 2009-04-12
Number of pages: 311
Author: Neil M. Gorsuch
Publisher: Princeton University Press

Download and read online The Future of Assisted Suicide and Euthanasia in PDF and EPUB After assessing the strengths and weaknesses of arguments for assisted suicide and euthanasia, Gorsuch builds a nuanced, novel, and powerful moral and legal argument against legalization, one based on a principle that, surprisingly, has largely been overlooked in the debate; the idea that human life is intrinsically valuable and that intentional killing is always wrong. At the same time, the argument Gorsuch develops leaves wide latitude for individual patient autonomy and the refusal of unwanted medical treatment and life-sustaining care, permitting intervention only in cases where an intention to kill is present.


The Three Laws of Performance

Filename: the-three-laws-of-performance.pdf
ISBN: 9781118170731
Release Date: 2011-07-28
Number of pages: 256
Author: Steve Zaffron
Publisher: John Wiley & Sons

Download and read online The Three Laws of Performance in PDF and EPUB A proven system for rallying all of an organizations' employees around a new vision and ideas for making the vision stick When something at work isn't going smoothly, managers struggle with what part of the problem to tackle first. Do they start with cost reduction? Or should they go for process improvements first? The authors—who have helped hundreds of companies and individuals change and improve—say spend time and money adjusting the systems in which people operate, rather than targeting people and their performance directly. The authors show that it's in fact possible to change everything at once—with a focus on making such transformations permanent and repeatable. Brand-new Introduction written for the paperback edition Filled with illustrative examples from Northrup Grumman, BHP-Billiton, Reebok, Harvard Business School, and many others Two experts in the field show how to make major transformations happen The book outlines a process for engaging all employees to buy-in to an improved vision of an organization's new and improved future.